T NCBI (GenBank accession code: AAT70096.1). DNA templates used for CF expression were transformed into E. coli strain DH5a and isolated by standard plasmid purification kits (Macherey-Nagel, Duren, Germany). ?Construct sGFPVector pIVEX 2.3dModification C-poly(His)Primer sequence1 F: TTTTGTTTAACTTTAAGAAGGAGATATAC ATATGAGCAAAGGAGAAGAACTTTTCAC R: GTGGTGGTGGTGGTGGTGGTGGTGGGATC CCTCGAGTGCGGCCGCAAGCTTTTTGTAGNApET21aC-poly(His)F: CGCGGATCCATGAAACCTGATGAAACTCCT R: CCGCTCGAGCTTTAGAAACCTCCGACACAGNA1-sGFPpET21aC-poly(His)10 TEV cleavageF: CTACATGTGTCGGAGGTTTCTAAAGGGCG AAAACCTGTACTTCCAGGGCG R: GGTGGTGGTGGTGGTGGTGCTCGAGTGCG GCCGCAAGCTTTTTGTAGAGCCurA- HalogenasepET28bN-poly(His)F: TCATGCCATATGCCAAAAACTATGA ACCGGGA R: TCATCGCTCGAGTTATTAGATGCTTG GTGTTTCCF: Forward; R: Reverse. doi:10.1371/journal.pone.0056637.tChemical Chaperones for Improving Protein QualityCell-free ExpressionBatch CF reactions were performed in 96 well V-shape microplates (PS-microplate 96 well V-shape, Greiner MedChemExpress BIBS39 Bio-One, Frickenhausen, Germany) in a final reaction volume of 25 ml at a temperature of 30uC and with gentle shaking. The basic reaction mixture (RM) contained 2.5 mM ATP, 1.7 mM each of GTP, UTP and CTP, 34 mg/ml folinic acid, 170 mg/ml E. coli tRNA mixture (Roche, Penzberg, Germany), 4?5 ng/ml of plasmid template DNA, 10 mg/ml T7 RNA polymerase, 2 mM each of the 20 proteinogenic amino acids, 0.53 mM NAD+, 0.26 mM CoA, 280 mM K+-glutamate, 10 mM NH4+-glutamate, 10 mM Mg2+glutamate, 1.5 mM spermidine, 1.5 mM putrescine, 4 mM Na+oxalate, 1 mM DTT and 0.24 (v/v) of S30 extract in analytical scale reactions or 31 (v/v) in preparative scale reactions (Table 2) [5]. If Mg2+ ions were not analyzed as Rubusoside screening reagent, the final Mg2+ concentration of the reaction was adjusted to 26 mM with Mg2+-glutamate. The 10-fold premix prepared for screening reactions contained 15 mM putrescine, 15 mM spermidine, 2.5 M K+-glutamate, 100 mM NH4+-glutamate, 100 mM Mg2+glutamate, 40 mM Na+-oxalate, 330 mM Na+-pyruvate, 340 mg/ ml folinic acid, 10 mM DTT, 5.3 mM NAD+(Table 2). The premix could be stored at 220uC and refrozen multiple times without detectable loss of efficiency.Compound ScreeningBatch reactions were pipetted with a Tecan Freedom EVO 200 device equipped with an eight channel liquid handling arm (461,000 ml and 4650 ml syringes) and two transport arms (Tecan, Mannedorf/Zurich, Switzerland). The pipetting range ??was in between 300 nl and 800 ml. Stock solutions of chemicals (Sigma-Aldrich, Steinheim, Germany) were prepared in either H2O or 500 mM HEPES-KOH buffer, pH 8.2, and kept on cooling carriers at 4uC upon pipetting. All additives were adjusted prior addition to 1317923 pH 8.2 by titration with either 500 mM HEPESKOH, pH 8.2, or with 100 mM L-glutamic acid. Linear concentration screening of selected single compounds as well as correlated concentration screening of two compounds was programmed by the custom designed EYES software based on theFigure 1. Linear concentration screens of basic CF batch reaction compounds. Expression efficiency was determined by sGFP fluorescence. A: Basic compounds S30 extract, DTT, NH4+, Mg2+; B: Plasmid templates. doi:10.1371/journal.pone.0056637.gFigure 2. Correlated concentration screens with Mg2+ ions. Expression efficiency was determined by sGFP fluorescence. A: NTP mix/Mg2+; B: PEP/Mg2+. doi:10.1371/journal.pone.0056637.gChemical Chaperones for Improving Protein Qualitywell (Circle): 262; Incubation time: 20 s; Settle time: 20 s. Protein concentra.T NCBI (GenBank accession code: AAT70096.1). DNA templates used for CF expression were transformed into E. coli strain DH5a and isolated by standard plasmid purification kits (Macherey-Nagel, Duren, Germany). ?Construct sGFPVector pIVEX 2.3dModification C-poly(His)Primer sequence1 F: TTTTGTTTAACTTTAAGAAGGAGATATAC ATATGAGCAAAGGAGAAGAACTTTTCAC R: GTGGTGGTGGTGGTGGTGGTGGTGGGATC CCTCGAGTGCGGCCGCAAGCTTTTTGTAGNApET21aC-poly(His)F: CGCGGATCCATGAAACCTGATGAAACTCCT R: CCGCTCGAGCTTTAGAAACCTCCGACACAGNA1-sGFPpET21aC-poly(His)10 TEV cleavageF: CTACATGTGTCGGAGGTTTCTAAAGGGCG AAAACCTGTACTTCCAGGGCG R: GGTGGTGGTGGTGGTGGTGCTCGAGTGCG GCCGCAAGCTTTTTGTAGAGCCurA- HalogenasepET28bN-poly(His)F: TCATGCCATATGCCAAAAACTATGA ACCGGGA R: TCATCGCTCGAGTTATTAGATGCTTG GTGTTTCCF: Forward; R: Reverse. doi:10.1371/journal.pone.0056637.tChemical Chaperones for Improving Protein QualityCell-free ExpressionBatch CF reactions were performed in 96 well V-shape microplates (PS-microplate 96 well V-shape, Greiner Bio-One, Frickenhausen, Germany) in a final reaction volume of 25 ml at a temperature of 30uC and with gentle shaking. The basic reaction mixture (RM) contained 2.5 mM ATP, 1.7 mM each of GTP, UTP and CTP, 34 mg/ml folinic acid, 170 mg/ml E. coli tRNA mixture (Roche, Penzberg, Germany), 4?5 ng/ml of plasmid template DNA, 10 mg/ml T7 RNA polymerase, 2 mM each of the 20 proteinogenic amino acids, 0.53 mM NAD+, 0.26 mM CoA, 280 mM K+-glutamate, 10 mM NH4+-glutamate, 10 mM Mg2+glutamate, 1.5 mM spermidine, 1.5 mM putrescine, 4 mM Na+oxalate, 1 mM DTT and 0.24 (v/v) of S30 extract in analytical scale reactions or 31 (v/v) in preparative scale reactions (Table 2) [5]. If Mg2+ ions were not analyzed as screening reagent, the final Mg2+ concentration of the reaction was adjusted to 26 mM with Mg2+-glutamate. The 10-fold premix prepared for screening reactions contained 15 mM putrescine, 15 mM spermidine, 2.5 M K+-glutamate, 100 mM NH4+-glutamate, 100 mM Mg2+glutamate, 40 mM Na+-oxalate, 330 mM Na+-pyruvate, 340 mg/ ml folinic acid, 10 mM DTT, 5.3 mM NAD+(Table 2). The premix could be stored at 220uC and refrozen multiple times without detectable loss of efficiency.Compound ScreeningBatch reactions were pipetted with a Tecan Freedom EVO 200 device equipped with an eight channel liquid handling arm (461,000 ml and 4650 ml syringes) and two transport arms (Tecan, Mannedorf/Zurich, Switzerland). The pipetting range ??was in between 300 nl and 800 ml. Stock solutions of chemicals (Sigma-Aldrich, Steinheim, Germany) were prepared in either H2O or 500 mM HEPES-KOH buffer, pH 8.2, and kept on cooling carriers at 4uC upon pipetting. All additives were adjusted prior addition to 1317923 pH 8.2 by titration with either 500 mM HEPESKOH, pH 8.2, or with 100 mM L-glutamic acid. Linear concentration screening of selected single compounds as well as correlated concentration screening of two compounds was programmed by the custom designed EYES software based on theFigure 1. Linear concentration screens of basic CF batch reaction compounds. Expression efficiency was determined by sGFP fluorescence. A: Basic compounds S30 extract, DTT, NH4+, Mg2+; B: Plasmid templates. doi:10.1371/journal.pone.0056637.gFigure 2. Correlated concentration screens with Mg2+ ions. Expression efficiency was determined by sGFP fluorescence. A: NTP mix/Mg2+; B: PEP/Mg2+. doi:10.1371/journal.pone.0056637.gChemical Chaperones for Improving Protein Qualitywell (Circle): 262; Incubation time: 20 s; Settle time: 20 s. Protein concentra.