Onstruct was generated in pRS316 and is identical in sequence to Eap1p-HA with the exception of the Y109A;L114A amino acid changes. Preparation of protein extracts by glass bead lysis and…
Ession level of the N-terminally his-tagged receptor could be obtained in yields of 0.3?.5 mg/liter of culture, which is the highest yield obtained for GPCRs from E.coli membrane ever reported.…
Esistance bialaphos (bar) gene. Subsequently, the AhSTS1 cDNA was inserted Autophagy between the BamHI and SacI site under the control of the Ubi1 promoter. The resulting plasmid was designated pSB2220.…
Weight of the inguinal, mesenteric and/or retroperitoneal fat depots in MIC-12/2 compared to control mice (Fig. 2C, 2D). These data indicate that MIC-1/GDF15 plays a role in regulating body composition…
Vel therapeutics will however require a clear understanding of how this relationship is regulated.Author ContributionsConceived and designed the experiments: CMW GEJ AMS AC SC. Performed the experiments: SC. Analyzed the…
58-49-1 chemical information energies and the energies with the fixed protein parts, and Ei,j the pairwise energies between the variables. As we are interested in improving binding affinity, we chose…
58-49-1 chemical information energies and the energies with the fixed protein parts, and Ei,j the pairwise energies between the variables. As we are interested in improving binding affinity, we chose…
Ison, WI). One ml of each reverse Autophagy transcriptase reaction was used as a template in a PCR reaction containing the following specific primer pairs: Cyclophilin (at2g36130) AGTCCGCCGGAGGTTACGCT (as normalizer)…
Btained by chromatin immunoprecipitation combined with high throughput sequencing (ChIP-seq). These studies reported between 1,600 and 2,800 Ll Em-myc) Mtap+/+mouse 370 322 329 331 336 353 309 343 369 341…
Uously and immunohistochemical staining of E-cadherin, ErbB2 and Slug were also performed on the adjacent sections as described previously . Briefly, tissues were fixed in 10 buffered formalin and embedded…